LeGO-iG2
(Plasmid #27341)

• Depositing Lab: Boris Fehse
• Publication: Weber et al Mol Ther. 2008 Apr . 16(4):698-706.

Backbone

• Vector backbone: LeGO
• Backbone size w/o insert (bp): 7829
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Any (like TOP10, XL10-Gold or Stbl)
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SFFV promoter, IRES-eGFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: GAGCTCACAACCCCTCACTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The eGFP cDNA is from Clontech. The lenti backbone is a derivative of pLentiLox3.7 developed at the MIT (http://web.mit.edu/jacks-lab/protocols/pll37.htm).
• Articles Citing this Plasmid:
  • 34 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

HIV-1 derived third generation lentiviral vector for the expression of a cDNA cloned into the multiple cloning site (BamHI, EcoRI, SbfI, StuI, NotI). An internal ribosome entry site (IRES) is used to express the marker gene. Use second generation (like psPAX2) or third generation (like pMDLg/pRRE + pRSV-Rev) systems for packaging in addition to a VSV-G expressing plasmid (or another envelope protein). Please visit the LeGO-Vector home page for more information: http://www.LentiGO-Vectors.de