PTRF/Cavin1_L (OZ513)
(Plasmid
#27188)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27188 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMG414
- Backbone size w/o insert (bp) 5493
-
Vector typeZebrafish Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Growth instructionsRequires a bacterial strain such as XL1 Blue, that expresses the lacIq allele of lac repressor
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameZinc finger array targeting PTRF/Cavin1
-
Alt namepolymerase I and transcript release factor b
-
Alt nameOZ514
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)270
-
GenBank IDENSDARG00000059362
-
Entrez Genecavin1b (a.k.a. fd20g07, ptrf, ptrfb, wu:fd20g07, zgc:162917)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer OK.61 GGGTAGTACGATGACGGAACCTGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid encodes a zinc finger array targeting half of a target sequence in the zebrafish gene PTRF/Cavin1 (see below). Please note that this plasmid does NOT contain the PTRF/Cavin1 sequence.
Users must order the complementary plasmid PTRF/Cavin1_R (OZ514) [Addgene plasmid 27189] in order to create a zinc finger nuclease (ZFN) pair to introduce targeted mutations into this specific zebrafish gene.
Users will also need to clone the zinc finger (ZF) insert of this plasmid into a zinc finger nuclease (ZFN) vector to express a FOKI fusion product. Examples of possible ZFN expression vectors that can be used are: pST1374 (Addgene plasmid 13426), pMLM290 (Addgene plasmid 21872), pMLM292 (Addgene plasmid 21873), pMLM800 (Addgene plasmid 27202) and pMLM802 (Addgene plasmid 27203).
This zinc finger array was tested for binding activity to the sequence 5'-GACGGCTGT-3' in a bacterial two hybrid assay, and resulted in 6.30 fold activation. However, this array has not yet been tested for activity as a zinc finger nuclease (i.e. for its ability to induce mutations at the intended locus).
Scientists using this zinc finger array in a publication should notify [email protected] and acknowledge NIH grant number R01 GM088040 in the publication.
Other Articles:
"Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays." Maeder ML et al. (Nat Protoc. 2009 Sept 17. 4(10):1471-1501. Pubmed ID: 19798082
"Targeted mutagenesis in zebrafish using customized zinc-finger nucleases." Foley JE et al. (Nat Protoc. 2009 Dec 3. 4(12):1855-1867. Pubmed ID: 20010934
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PTRF/Cavin1_L (OZ513) was a gift from Keith Joung (Addgene plasmid # 27188 ; http://n2t.net/addgene:27188 ; RRID:Addgene_27188) -
For your References section:
Rapid "open-source" engineering of customized zinc-finger nucleases for highly efficient gene modification. Maeder ML, Thibodeau-Beganny S, Osiak A, Wright DA, Anthony RM, Eichtinger M, Jiang T, Foley JE, Winfrey RJ, Townsend JA, Unger-Wallace E, Sander JD, Muller-Lerch F, Fu F, Pearlberg J, Goebel C, Dassie JP, Pruett-Miller SM, Porteus MH, Sgroi DC, Iafrate AJ, Dobbs D, McCray PB, Cathomen T, Voytas DF, Joung JK. Mol Cell. 2008 Jul 25. 31(2):294-301. 10.1016/j.molcel.2008.06.016 PubMed 18657511