pLVX-TetOne-Puro-mitoEcSTH-FLAG
(Plasmid
#218629)
-
PurposeThis plasmid contains human codon optimized sequence of mitoEcSTH which is a soluble transhydrogenase from E. coli that can be used to increase NADH/NAD+ ratio in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 218629 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLVX-TetOne-Puro
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 9227
- Total vector size (bp) 10763
-
Vector typeMammalian Expression, Lentiviral, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemitoEcSTH
-
SpeciesE. coli
-
Insert Size (bp)1536
-
Tags
/ Fusion Proteins
- FLAG (C terminal on insert)
- MTS (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer ACGGCCCTCCTGTCTTAGGTTAGTGAAAAATGT
- 3′ sequencing primer CTTTGCTTATGTAAACCAGGGCGCCTAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-TetOne-Puro-mitoEcSTH-FLAG was a gift from Valentin Cracan (Addgene plasmid # 218629 ; http://n2t.net/addgene:218629 ; RRID:Addgene_218629) -
For your References section:
A genetically encoded tool to increase cellular NADH/NAD(+) ratio in living cells. Pan X, Heacock ML, Abdulaziz EN, Violante S, Zuckerman AL, Shrestha N, Yao C, Goodman RP, Cross JR, Cracan V. Nat Chem Biol. 2023 Oct 26. doi: 10.1038/s41589-023-01460-w. 10.1038/s41589-023-01460-w PubMed 37884806