Skip to main content
Addgene

Membrane mCherry
(Plasmid #210470)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210470 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCS2+8
  • Backbone size w/o insert (bp) 4137
  • Total vector size (bp) 4909
  • Vector type
    Synthetic Biology ; sea urchin, mammal, zebrafish

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LCK membrane mCherry
  • Alt name
    LCK proto-oncogene, Src family tyrosine kinase
  • Species
    H. sapiens (human), Synthetic; A.victoria
  • Insert Size (bp)
    828
  • Entrez Gene
    LCK (a.k.a. IMD22, LSK, YT16, p56lck, pp58lck)
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TGACGTAAATGGGCGGTAGG
  • 3′ sequencing primer GTCATAGCTGTTTCCTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Twist Bioscience

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Membrane mCherry was a gift from Amro Hamdoun (Addgene plasmid # 210470 ; http://n2t.net/addgene:210470 ; RRID:Addgene_210470)