TRE-Lepr_FL-IRES-eGFP
(Plasmid
#196635)
-
PurposeDoxycycline inducible expression of full length mouse Lepr with eGFP marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196635 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTET-IRES-EGFP
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLepr
-
SpeciesM. musculus (mouse)
-
Entrez GeneLepr (a.k.a. LEPROT, Leprb, Modb1, OB-RGRP, Obr, db, diabetes, obese-like, obl)
- Promoter TRE
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGAGCTCGTTTAGTGAACCG
- 3′ sequencing primer AACGCACACCGGCCTTATTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRE-Lepr_FL-IRES-eGFP was a gift from Elaine Fuchs (Addgene plasmid # 196635 ; http://n2t.net/addgene:196635 ; RRID:Addgene_196635) -
For your References section:
Ras drives malignancy through stem cell crosstalk with the microenvironment. Yuan S, Stewart KS, Yang Y, Abdusselamoglu MD, Parigi SM, Feinberg TY, Tumaneng K, Yang H, Levorse JM, Polak L, Ng D, Fuchs E. Nature. 2022 Nov 30. doi: 10.1038/s41586-022-05475-6. 10.1038/s41586-022-05475-6 PubMed 36450983