Skip to main content
Addgene

TRE-Lepr_FL-IRES-eGFP
(Plasmid #196635)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196635 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTET-IRES-EGFP
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lepr
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Lepr (a.k.a. LEPROT, Leprb, Modb1, OB-RGRP, Obr, db, diabetes, obese-like, obl)
  • Promoter TRE

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AGAGCTCGTTTAGTGAACCG
  • 3′ sequencing primer AACGCACACCGGCCTTATTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TRE-Lepr_FL-IRES-eGFP was a gift from Elaine Fuchs (Addgene plasmid # 196635 ; http://n2t.net/addgene:196635 ; RRID:Addgene_196635)
  • For your References section:

    Ras drives malignancy through stem cell crosstalk with the microenvironment. Yuan S, Stewart KS, Yang Y, Abdusselamoglu MD, Parigi SM, Feinberg TY, Tumaneng K, Yang H, Levorse JM, Polak L, Ng D, Fuchs E. Nature. 2022 Nov 30. doi: 10.1038/s41586-022-05475-6. 10.1038/s41586-022-05475-6 PubMed 36450983