LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
(Plasmid
#192684)
-
PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcription
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192684 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman IL1RN activating gRNAs #1,2,3
-
gRNA/shRNA sequenceGCATCAAGTCAGCCATCAGC, TGTACTCTCTGAGGTGCTC, ACGCAGATAAGAACCAGTT
-
SpeciesH. sapiens (human)
-
Entrez GeneIL1RN (a.k.a. CRMO2, DIRA, ICIL-1RA, IL-1RN, IL-1ra, IL-1ra3, IL1F3, IL1RA, IRAP, MVCD4)
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid lacks cPPT/CTS, but depositor confirmed that plasmid function is not affected.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro was a gift from Jeffrey Miner (Addgene plasmid # 192684 ; http://n2t.net/addgene:192684 ; RRID:Addgene_192684) -
For your References section:
Comparative analysis of dCas9-VP64 variants and multiplexed guide RNAs mediating CRISPR activation. Omachi K, Miner JH. PLoS One. 2022 Jun 28;17(6):e0270008. doi: 10.1371/journal.pone.0270008. eCollection 2022. 10.1371/journal.pone.0270008 PubMed 35763517