Skip to main content
Addgene

promoter-less mRFP1_Violet
(Plasmid #183139)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183139 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    BioBrick pSB1C3 vector
  • Backbone manufacturer
    iGEM Registry
  • Modifications to backbone
    BioBrick sites removed
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RBS, mRFP1E_Violet
  • Species
    Synthetic
  • Insert Size (bp)
    767
  • Mutation
    BioBrick sites removed

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BioBrick prefix (unknown if destroyed)
  • 3′ cloning site BioBrick suffix (unknown if destroyed)
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    promoter-less mRFP1_Violet was a gift from Anthony Forster (Addgene plasmid # 183139 ; http://n2t.net/addgene:183139 ; RRID:Addgene_183139)
  • For your References section:

    Overcoming chromoprotein limitations by engineering a red fluorescent protein. Bao L, Menon PNK, Liljeruhm J, Forster AC. Anal Biochem. 2020 Sep 3:113936. doi: 10.1016/j.ab.2020.113936. 10.1016/j.ab.2020.113936 PubMed 32891596