pORANGE_NFL linker-3xFLAG KI
(Plasmid
#182679)
-
PurposeExpression of spCas9, gRNA targeting the end of mouse Nefl gene and donor linker-3xFLAG. Can be used for C-terminal tagging of endogenous NFL with a linker-3xFLAG tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182679 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepORANGE
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNefl-targeting gRNA and linker-3xFLAG donor sequence
-
Alt nameNefl
-
gRNA/shRNA sequenceGAGTGCTGGAGAGGAGCAGG
-
SpeciesM. musculus (mouse)
-
GenBank ID
-
Entrez GeneNefl (a.k.a. CMT2E, NF-L, NF68, Nfl)
- Promoter U6 and chicken beta-actin promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer NA
- 3′ sequencing primer NA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFollowing pORANGE cloning template vector (https://www.addgene.org/131471/) was used as a vector backbone.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pORANGE_NFL linker-3xFLAG KI was a gift from Ivana Nikić-Spiegel (Addgene plasmid # 182679 ; http://n2t.net/addgene:182679 ; RRID:Addgene_182679) -
For your References section:
Minimal genetically encoded tags for fluorescent protein labeling in living neurons. Arsic A, Hagemann C, Stajkovic N, Schubert T, Nikic-Spiegel I. Nat Commun. 2022 Jan 14;13(1):314. doi: 10.1038/s41467-022-27956-y. 10.1038/s41467-022-27956-y PubMed 35031604