pET28-T7-NlaCas3-NLS-6xHis
(Plasmid
#180214)
-
PurposeExpressing Neisseria lactamica Type I-C Cas3 with NLS and His tag on the C terminus for protein purification in E.Coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180214 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5203
- Total vector size (bp) 7771
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNlaCas3c
-
Alt nameDR91_RS04465
-
SpeciesNeisseria lactamica
-
Insert Size (bp)2568
-
GenBank IDNZ_KN046803.1
- Promoter T7
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTAGTTATTGCTCAGCGG
- 3′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28-T7-NlaCas3-NLS-6xHis was a gift from Yan Zhang (Addgene plasmid # 180214 ; http://n2t.net/addgene:180214 ; RRID:Addgene_180214) -
For your References section:
Cas11 enables genome engineering in human cells with compact CRISPR-Cas3 systems. Tan R, Krueger RK, Gramelspacher MJ, Zhou X, Xiao Y, Ke A, Hou Z, Zhang Y. Mol Cell. 2022 Feb 17;82(4):852-867.e5. doi: 10.1016/j.molcel.2021.12.032. Epub 2022 Jan 19. 10.1016/j.molcel.2021.12.032 PubMed 35051351