ptia1l-hsp-GFP
(Plasmid #177837)

• Purpose: Donor plasmid for knock-in of hsp70-EGFP using CRISPR-Cas9
• Depositing Lab: David Kingsley
• Publication: Wucherpfennig et al Nat Ecol Evol. 2022 Sep 1. pii: 10.1038/s41559-022-01855-3. doi: 10.1038/s41559-022-01855-3.

Backbone

• Vector backbone: pCR2.1-TOPO
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 3931
• Total vector size (bp): 6637
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: tia1l-sgRNA target site-hsp70-EGFP
• Species: D. rerio (zebrafish)
• Insert Size (bp): 2705
• Promoter: hsp70
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGTAAAACGACGGCCAGT
• 3′ sequencing primer: CAGGAAACAGCTATGACCATG

Resource Information

• Supplemental Documents:
  • ptia1l-hsp-GFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The tia1l sgRNA was designed and published by Hwang et al., 2013, Nature Biotechnology: https://pubmed.ncbi.nlm.nih.gov/23360964/.

The strategy is based on a method described by Lackner et al. 2015, Nature Communications: https://pubmed.ncbi.nlm.nih.gov/26674669/.