pGFP-Ub-VPS13D
(Plasmid
#176462)
-
Purposeexpressing GFP-Ub marked VPS13D in mammalian cells. GFP-Ub will be cleaved by DUBs to express untagged VPS13D
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3679
- Total vector size (bp) 18015
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVPS13D
-
Alt nameSCAR4
-
SpeciesH. sapiens (human)
-
GenBank IDNM_015378 ENSG00000048707
-
Entrez GeneVPS13D (a.k.a. BLTP5D, SCAR4)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP-Ub (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGAAGCGCGATCACATGG
- 3′ sequencing primer CATTTTATGTTTCAGGTTCAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GFP-Ub-VPS13D will be translated into one fusion protein. However, endogenous DUBs will cleave it into GFP-Ub and VPS13D fragments. GFP-Ub hence acts as a fluorescent reporter for VPS13D expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGFP-Ub-VPS13D was a gift from Richard Youle (Addgene plasmid # 176462 ; http://n2t.net/addgene:176462 ; RRID:Addgene_176462) -
For your References section:
VPS13D promotes peroxisome biogenesis. Baldwin HA, Wang C, Kanfer G, Shah HV, Velayos-Baeza A, Dulovic-Mahlow M, Bruggemann N, Anding A, Baehrecke EH, Maric D, Prinz WA, Youle RJ. J Cell Biol. 2021 May 3;220(5). pii: 212018. doi: 10.1083/jcb.202001188. 10.1083/jcb.202001188 PubMed 33891012