pAAV gfaABC1D NES-jRCaMP1a
(Plasmid
#171120)
-
PurposeAstrocyte AAV-mediated expression of jRCaMP1a, a red fluorescent calcium sensor protein.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171120 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5039
- Total vector size (bp) 6448
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namejRCaMP1a
-
Alt nameRCaMP1h variant 1488
-
SpeciesSynthetic
-
Insert Size (bp)1409
- Promoter gfaABC1D
-
Tag
/ Fusion Protein
- His Tag, T7 Tag, XpressTag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGTCGTGAGGCACTGGGCAG
- 3′ sequencing primer GGCATTAAAGCAGCGTATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byjRCaMP1a is from Douglas Kim, GENIE Project Addgene ID #61562 The promotor is from Baljit Khakh Addgene ID #52925,
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV gfaABC1D NES-jRCaMP1a was a gift from Thomas Oertner (Addgene plasmid # 171120 ; http://n2t.net/addgene:171120 ; RRID:Addgene_171120) -
For your References section:
Using Genetically Encoded Calcium Indicators to Study Astrocyte Physiology: A Field Guide. Lohr C, Beiersdorfer A, Fischer T, Hirnet D, Rotermund N, Sauer J, Schulz K, Gee CE. Front Cell Neurosci. 2021 Jun 11;15:690147. doi: 10.3389/fncel.2021.690147. eCollection 2021. 10.3389/fncel.2021.690147 PubMed 34177468