Skip to main content
Addgene

FASTHDR-Cterm-mClover3-Puromycin
(Plasmid #167205)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 167205 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    puc57
  • Backbone size (bp) 2458
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin
  • Tag / Fusion Protein
    • mClover3 (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Growth instructions
    The empty plasmid must be maintained in E.coli DB3.1. Once the plasmid is used to insert homologous recombination arms, the plasmid must be transformed in a strain that is sensitive to ccdb such as DH5Alpha or similar.
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcagattgtactgagagtgcaccata
  • 3′ sequencing primer caggttttgctttttggcctttccc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FASTHDR-Cterm-mClover3-Puromycin was a gift from Oscar Perez (Addgene plasmid # 167205 ; http://n2t.net/addgene:167205 ; RRID:Addgene_167205)
  • For your References section:

    Multiplex Gene Tagging with CRISPR-Cas9 for Live-Cell Microscopy and Application to Study the Role of SARS-CoV-2 Proteins in Autophagy, Mitochondrial Dynamics, and Cell Growth. Perez-Leal O, Nixon-Abell J, Barrero CA, Gordon JC, Oesterling J, Rico MC. CRISPR J. 2021 Nov 30. doi: 10.1089/crispr.2021.0041. 10.1089/crispr.2021.0041 PubMed 34847745