pRM27
(Plasmid
#163695)
-
Purposeubb promoter driven expression of lck:mNeonGreen
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163695 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepminiTol2
-
Backbone manufacturerStephen Ekker (Plasmid #31829)
- Backbone size w/o insert (bp) 7065
- Total vector size (bp) 7805
-
Modifications to backboneubb promoter inserted at BamHI site, lck:mNeonGreen inserted between BamHI and ClaI
-
Vector typeZebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelck:mNeonGreen
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)740
-
Entrez Genelck (a.k.a. zgc:136695)
- Promoter ubb
-
Tag
/ Fusion Protein
- mNeonGreen (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAATACGACTCACTATAGGG
- 3′ sequencing primer ATTAACCCTCACTAAAGGGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRM27 was a gift from David Matus (Addgene plasmid # 163695 ; http://n2t.net/addgene:163695 ; RRID:Addgene_163695) -
For your References section:
Visualizing the metazoan proliferation-quiescence decision in vivo. Adikes RC, Kohrman AQ, Martinez MAQ, Palmisano NJ, Smith JJ, Medwig-Kinney TN, Min M, Sallee MD, Ahmed OB, Kim N, Liu S, Morabito RD, Weeks N, Zhao Q, Zhang W, Feldman JL, Barkoulas M, Pani AM, Spencer SL, Martin BL, Matus DQ. Elife. 2020 Dec 22;9. pii: 63265. doi: 10.7554/eLife.63265. 10.7554/eLife.63265 PubMed 33350383