pBAD_IPF2.0
(Plasmid
#163124)
-
PurposeA plasmid with IFP2.0 coding sequence coded into it. Expresses IFP2.0 with N-term His-tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163124 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBAD
- Backbone size w/o insert (bp) 5441
- Total vector size (bp) 6140
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFP2.0
-
SpeciesDeinococcus radiodurans
-
Insert Size (bp)966
-
Tag
/ Fusion Protein
- His (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCCATAGCATTTTTATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypBAD vector was cloned from Addgene #54762 IFP2.0 insert was cloned from Addgene #54785
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD_IPF2.0 was a gift from Julie Biteen (Addgene plasmid # 163124 ; http://n2t.net/addgene:163124 ; RRID:Addgene_163124) -
For your References section:
Imaging living obligate anaerobic bacteria with bilin-binding fluorescent proteins. Chia HE, Zuo T, Koropatkin NM, Marsh ENG, Biteen JS. Curr Res Microb Sci. 2020 Sep;1:1-6. doi: 10.1016/j.crmicr.2020.04.001. Epub 2020 May 11. 10.1016/j.crmicr.2020.04.001 PubMed 33313576