Skip to main content
Addgene

pMOS018E: Entry vector for: ratiometric pHluorin (mitchondrial)
(Plasmid #163070)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163070 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pENTR
  • Backbone size w/o insert (bp) 2586
  • Vector type
    Gateway entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ratiometric pHluorin
  • Species
    Synthetic
  • Insert Size (bp)
    822

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CTACAAACTCTTCCTGTTAGTTAG
  • 3′ sequencing primer ATGGCTCATAACACCCCTTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Gero Miesenboeck

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please see PMID: 9671304 for original reporter gene characterization.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMOS018E: Entry vector for: ratiometric pHluorin (mitchondrial) was a gift from Adam Cohen (Addgene plasmid # 163070 ; http://n2t.net/addgene:163070 ; RRID:Addgene_163070)
  • For your References section:

    Multiplexed Optical Sensors in Arrayed Islands of Cells for multimodal recordings of cellular physiology. Werley CA, Boccardo S, Rigamonti A, Hansson EM, Cohen AE. Nat Commun. 2020 Aug 4;11(1):3881. doi: 10.1038/s41467-020-17607-5. 10.1038/s41467-020-17607-5 PubMed 32753572