-
PurposeExpresses human ACE2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161758 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepLentiEGFPdestablized
- Backbone size w/o insert (bp) 8770
- Total vector size (bp) 11215
-
Modifications to backboneEGFP-PEST sequence was removed
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman ACE2
-
Alt namehACE2, ACE2
-
SpeciesH. sapiens (human)
-
Entrez GeneACE2 (a.k.a. ACEH)
- Promoter EF1a
-
Tag
/ Fusion Protein
- P2A (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcacctcgattagttctcgag
- 3′ sequencing primer caaggaggagaaaatgaaagcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-hACE2-hygro was a gift from Neville Sanjana (Addgene plasmid # 161758 ; http://n2t.net/addgene:161758 ; RRID:Addgene_161758) -
For your References section:
Identification of Required Host Factors for SARS-CoV-2 Infection in Human Cells. Daniloski Z, Jordan TX, Wessels HH, Hoagland DA, Kasela S, Legut M, Maniatis S, Mimitou EP, Lu L, Geller E, Danziger O, Rosenberg BR, Phatnani H, Smibert P, Lappalainen T, tenOever BR, Sanjana NE. Cell. 2020 Oct 24. pii: S0092-8674(20)31394-5. doi: 10.1016/j.cell.2020.10.030. 10.1016/j.cell.2020.10.030 PubMed 33147445