-
PurposeEncodes SARS-CoV-2 Spike with 21 aa C-terminal deletions for lentiviral pseudotyping
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155130 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneHDM
- Backbone size w/o insert (bp) 4750
- Total vector size (bp) 8314
-
Modifications to backboneCGCCACC added 3' to EcoRI site and 5' to S start codon
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 Spike-delta21
-
Alt nameCodon optimized SARS-CoV-2 Spike
-
SpeciesSevere acute respiratory syndrome coronavirus 2
-
Insert Size (bp)3762
-
MutationCodon optimized to H. sapiens using IDT codon optimization tool; deleted 21 amino acids by deletion from 3769-3831
-
GenBank ID43740568
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CGCATGGTGTGGTCTTTCTCC
- 3′ sequencing primer agtccaagctaggcccttttg
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Based on a plasmid described previously in Crawford et al. 2020, Protocol and Reagents for Pseudotyping Lentiviral Particles with SARS-CoV-2 Spike Protein for Neutralization Assays (https://www.mdpi.com/1999-4915/12/5/513) This is a version of the Spike expression plasmid used to pseudotype lentivirus which provided better titers in this protocol.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HDM-SARS2-Spike-delta21 was a gift from Jesse Bloom (Addgene plasmid # 155130 ; http://n2t.net/addgene:155130 ; RRID:Addgene_155130) -
For your References section:
Protocol and Reagents for Pseudotyping Lentiviral Particles with SARS-CoV-2 Spike Protein for Neutralization Assays. Crawford KHD, Eguia R, Dingens AS, Loes AN, Malone KD, Wolf CR, Chu HY, Tortorici MA, Veesler D, Murphy M, Pettie D, King NP, Balazs AB, Bloom JD. Viruses. 2020 May 6;12(5). pii: v12050513. doi: 10.3390/v12050513. 10.3390/v12050513 PubMed 32384820