pZmUbi-5'UTR
(Plasmid #154057)

• Purpose: Level 0 Golden Gate vector, containing the ZmUbi promoter and 5' UTR with Level 0.5-compatible overhangs (Wheat construct)
• Depositing Lab: Cristobal Uauy
• Publication: Harrington et al Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020.

Backbone

• Vector backbone: pUAP1
• Backbone size w/o insert (bp): 3138
• Total vector size (bp): 4049
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Promoter and 5' UTR Ubiquitin (Zea mays)
• Alt name: pZmUbi + 5' UTR
• Insert Size (bp): 1987
• Promoter: N/A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: TGCCACCTGACGTCTAAGAA
• 3′ sequencing primer: CCTGCAGAAGTAACACCAAA

Resource Information

• Supplemental Documents:
  • level0_mzubi5utr_tactending.gb
• A portion of this plasmid was derived from a plasmid made by: The ZmUbi promoter and 5' UTR sequence is derived from the pICSL12009 plasmid, developed by Nicola Patron.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry