pCEFL GAL4dbd-KLF4 159-329
(Plasmid
#140148)
-
PurposeGAL4-DNA binding domain fusion protein with amino acids 159 to 329 of human KLF4 (repressor domain)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140148 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCEFL
- Total vector size (bp) 7012
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKLF4 aa 159-329
-
SpeciesH. sapiens (human)
-
MutationDeleted amino acids 1 to 158 and 330 to 479
-
GenBank IDNM_004235
-
Entrez GeneKLF4 (a.k.a. EZF, GKLF)
- Promoter EF1a
-
Tag
/ Fusion Protein
- GAL4dbd (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TTCTTCCATTTCAGGTGTCG
- 3′ sequencing primer ATT TAG GTG ACA CTA TAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCEFL GAL4dbd-KLF4 159-329 was a gift from Ramiro Iglesias-Bartolome (Addgene plasmid # 140148 ; http://n2t.net/addgene:140148 ; RRID:Addgene_140148) -
For your References section:
YAP1/TAZ-TEAD transcriptional networks maintain skin homeostasis by regulating cell proliferation and limiting KLF4 activity. Yuan Y, Park J, Feng A, Awasthi P, Wang Z, Chen Q, Iglesias-Bartolome R. Nat Commun. 2020 Mar 19;11(1):1472. doi: 10.1038/s41467-020-15301-0. 10.1038/s41467-020-15301-0 PubMed 32193376