pEJS1005-Lenti-mammalian c.o.AcrIIA5-FLAG-NLS-HygR
(Plasmid
#136514)
-
PurposeExpresses type II-A anti-CRISPR protein AcrIIA5 in mammalian cells in a lentiviral vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136514 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 7514
- Total vector size (bp) 7994
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCodon-optimized AcrIIA5
-
Insert Size (bp)480
- Promoter SFFV
-
Tag
/ Fusion Protein
- FLAG/NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACCTGTAGGTTTGGCAA
- 3′ sequencing primer TATAGTTCTAGAGGCTCGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEJS1005-Lenti-mammalian c.o.AcrIIA5-FLAG-NLS-HygR was a gift from Erik Sontheimer (Addgene plasmid # 136514 ; http://n2t.net/addgene:136514 ; RRID:Addgene_136514) -
For your References section:
Anti-CRISPR AcrIIA5 Potently Inhibits All Cas9 Homologs Used for Genome Editing. Garcia B, Lee J, Edraki A, Hidalgo-Reyes Y, Erwood S, Mir A, Trost CN, Seroussi U, Stanley SY, Cohn RD, Claycomb JM, Sontheimer EJ, Maxwell KL, Davidson AR. Cell Rep. 2019 Nov 12;29(7):1739-1746.e5. doi: 10.1016/j.celrep.2019.10.017. 10.1016/j.celrep.2019.10.017 PubMed 31722192