-
Purposestably express both mKeima and FRB-Fis1 for CID induced mitophagy in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135295 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHAGE
- Backbone size w/o insert (bp) 6436
- Total vector size (bp) 7783
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemt-mKeima-P2A-FRB-Fis1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1341
-
Mutationmt-mKeima is fused with FRB-Fis1 via P2A seqeunce
-
GenBank IDNM_016068.3
-
Entrez GeneFIS1 (a.k.a. CGI-135, TTC11)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE-mt-mKeima-P2A-FRB-Fis1 was a gift from Richard Youle (Addgene plasmid # 135295 ; http://n2t.net/addgene:135295 ; RRID:Addgene_135295) -
For your References section:
Spatiotemporal Control of ULK1 Activation by NDP52 and TBK1 during Selective Autophagy. Vargas JNS, Wang C, Bunker E, Hao L, Maric D, Schiavo G, Randow F, Youle RJ. Mol Cell. 2019 Apr 18;74(2):347-362.e6. doi: 10.1016/j.molcel.2019.02.010. Epub 2019 Mar 7. 10.1016/j.molcel.2019.02.010 PubMed 30853401