VfAU1-LOV_P2A_casp9
(Plasmid
#131224)
-
PurposeExpresses Ha-tagged VfAU1-LOV and myc-tagged casp9 (domains of Opto-casp9) separated by P2A site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1-
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5318
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVfAU1-LOV-HA_P2A_myc-casp9
-
SpeciesH. sapiens (human); V. frigida
-
Insert Size (bp)1443
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer CMV_F (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer pcDNA_R (CAACAGATGGCTGGCAAC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VfAU1-LOV_P2A_casp9 was a gift from Harald Janovjak (Addgene plasmid # 131224 ; http://n2t.net/addgene:131224 ; RRID:Addgene_131224) -
For your References section:
Engineering Strategy and Vector Library for the Rapid Generation of Modular Light-Controlled Protein-Protein Interactions. Tichy AM, Gerrard EJ, Legrand JMD, Hobbs RM, Janovjak H. J Mol Biol. 2019 May 29. pii: S0022-2836(19)30317-1. doi: 10.1016/j.jmb.2019.05.033. 10.1016/j.jmb.2019.05.033 PubMed 31150735