-
Purposebicistronic AAV vector to express GCaMP6m and soma-targeted ChRmine under the control of CamKIIa promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131003 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChRmine
-
SpeciesTiarina fusus
-
GenBank IDMN194599
- Promoter CaMKIIa
-
Tag
/ Fusion Protein
- Kv2.1-HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTGGATGCTGACGAAGGCTCG
- 3′ sequencing primer GAATACCAGTCAATCTTTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CaMKIIa-GCaMP 6m-p2A-ChRmine-Kv2.1-WPRE was a gift from Karl Deisseroth (Addgene plasmid # 131003 ; http://n2t.net/addgene:131003 ; RRID:Addgene_131003) -
For your References section:
Cortical layer-specific critical dynamics triggering perception. Marshel JH, Kim YS, Machado TA, Quirin S, Benson B, Kadmon J, Raja C, Chibukhchyan A, Ramakrishnan C, Inoue M, Shane JC, McKnight DJ, Yoshizawa S, Kato HE, Ganguli S, Deisseroth K. Science. 2019 Aug 9;365(6453). pii: science.aaw5202. doi: 10.1126/science.aaw5202. Epub 2019 Jul 18. 10.1126/science.aaw5202 PubMed 31320556