-
PurposeFluorescent reporter for serotonin (dendrite localization tag)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128485 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
AAV9 | 128485-AAV9 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | $405 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 7410
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiSeroSnFR
-
Insert Size (bp)2410
- Promoter CAG
-
Tags
/ Fusion Proteins
- Ig-kappa leader (N terminal on insert)
- Full-length neuroligin (C terminal on insert)
- cpsfGFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer pCAG-N - cctccttgtataaatcctgg
- 3′ sequencing primer pCAG-C - ccaggatttatacaaggagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene QC NGS analysis was unable to verify both AAV ITR sequences. It is unknown if this may impact plasmid function.
Information for AAV9 (Catalog # 128485-AAV9) ( Back to top)
Purpose
Ready-to-use AAV9 particles produced from pAAV-CAG-iSeroSnFR-Nlgn (#128485). In addition to the viral particles, you will also receive purified pAAV-CAG-iSeroSnFR-Nlgn plasmid DNA.
CAG-driven expression of a fluorescent reporter for serotonin (localized to dendrites). These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV9
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-iSeroSnFR-Nlgn was a gift from Lin Tian (Addgene plasmid # 128485 ; http://n2t.net/addgene:128485 ; RRID:Addgene_128485) For viral preps, please replace (Addgene plasmid # 128485) in the above sentence with: (Addgene viral prep # 128485-AAV9) -
For your References section:
Directed Evolution of a Selective and Sensitive Serotonin Sensor via Machine Learning. Unger EK, Keller JP, Altermatt M, Liang R, Matsui A, Dong C, Hon OJ, Yao Z, Sun J, Banala S, Flanigan ME, Jaffe DA, Hartanto S, Carlen J, Mizuno GO, Borden PM, Shivange AV, Cameron LP, Sinning S, Underhill SM, Olson DE, Amara SG, Temple Lang D, Rudnick G, Marvin JS, Lavis LD, Lester HA, Alvarez VA, Fisher AJ, Prescher JA, Kash TL, Yarov-Yarovoy V, Gradinaru V, Looger LL, Tian L. Cell. 2020 Dec 12. pii: S0092-8674(20)31612-3. doi: 10.1016/j.cell.2020.11.040. 10.1016/j.cell.2020.11.040 PubMed 33333022