pAC10108_pAAVS1-Nst-EF1aHygro2ArtTA3(-)_TetO-Blast-P2A-mScarlet
(Plasmid
#122828)
-
PurposePlasmid 108
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122828 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAVS1-Nst-CAG-DEST (Addgene #80489)
-
Modifications to backboneReplaced CAG-DEST with EF1aHygro2ArtTA3(-)_TetO-DEST
-
Vector typeCRISPR ; Donor vector
-
Selectable markersNeomycin (select with G418), Hygromycin, Blasticidin ; Dox-inducible Blast-P2A-mScarlet
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBlast-P2A-mScarlet
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer taggcgtgtacggtgggagg
- 3′ sequencing primer ACCGAGGAGAGGGTTAGGGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/452979v2 for BioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC10108_pAAVS1-Nst-EF1aHygro2ArtTA3(-)_TetO-Blast-P2A-mScarlet was a gift from Albert Cheng (Addgene plasmid # 122828) -
For your References section:
Split Selectable Markers. Jillette N, Du M, Cheng AW. bioRxiv 452979 10.1101/452979