pAC10058_pLX-DEST-IRES-NpuDnaE(C)-Neo(195-267)
(Plasmid
#122781)
-
PurposePlasmid 58:Lentiviral Gateway desination vector encoding NpuDnaE(C)-Neo(195-267)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122781 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLX302 (Addgene #25896)
-
Modifications to backbonePuromycin removed
-
Vector typeMammalian Expression, Lentiviral ; Gateway Destination
-
Selectable markersNpuDnaE(C)-Neo(195-267)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNpuDnaE(C)-Neo(195-267)
-
SpeciesSynthetic
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TCCTCGGTCTCGATTCTACG
- 3′ sequencing primer agcagcgtatccacatagcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/452979v2 for BioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC10058_pLX-DEST-IRES-NpuDnaE(C)-Neo(195-267) was a gift from Albert Cheng (Addgene plasmid # 122781) -
For your References section:
Split Selectable Markers. Jillette N, Du M, Cheng AW. bioRxiv 452979 10.1101/452979