pHLSec2-irisin-his
(Plasmid
#122729)
-
PurposeExpresses in mammalian cells (HEK293):glycosylated and secreted irisin-his
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122729 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHLSec2
- Backbone size w/o insert (bp) 4600
- Total vector size (bp) 4962
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameirisin (ectodomain of FNDC5)
-
Alt nameFNDC5
-
SpeciesH. sapiens (human), M. musculus (mouse), R. norvegicus (rat), B. taurus (bovine)
-
Insert Size (bp)441
-
GenBank IDNM_027402.3
-
Entrez GeneFndc5 (a.k.a. 1500001L03Rik, PeP, Pxp)
-
Tags
/ Fusion Proteins
- his (C terminal on insert)
- signal sequence for secretion (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTACAGCTCCTGGGCAACGTG
- 3′ sequencing primer TCAGTGGTATTTGTGAGCCAGGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please Note: Addgene NGS is unable to fully resolve the CAG promoter sequence. Please refer to the depositor's sequence for this section of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHLSec2-irisin-his was a gift from Harold Erickson (Addgene plasmid # 122729 ; http://n2t.net/addgene:122729 ; RRID:Addgene_122729) -
For your References section:
Irisin - a myth rather than an exercise-inducible myokine. Albrecht E, Norheim F, Thiede B, Holen T, Ohashi T, Schering L, Lee S, Brenmoehl J, Thomas S, Drevon CA, Erickson HP, Maak S. Sci Rep. 2015 Mar 9;5:8889. doi: 10.1038/srep08889. 10.1038/srep08889 PubMed 25749243