Skip to main content
Addgene

pHLSec2-irisin-his
(Plasmid #122729)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122729 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHLSec2
  • Backbone size w/o insert (bp) 4600
  • Total vector size (bp) 4962
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    irisin (ectodomain of FNDC5)
  • Alt name
    FNDC5
  • Species
    H. sapiens (human), M. musculus (mouse), R. norvegicus (rat), B. taurus (bovine)
  • Insert Size (bp)
    441
  • GenBank ID
    NM_027402.3
  • Entrez Gene
    Fndc5 (a.k.a. 1500001L03Rik, PeP, Pxp)
  • Tags / Fusion Proteins
    • his (C terminal on insert)
    • signal sequence for secretion (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTACAGCTCCTGGGCAACGTG
  • 3′ sequencing primer TCAGTGGTATTTGTGAGCCAGGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please Note: Addgene NGS is unable to fully resolve the CAG promoter sequence. Please refer to the depositor's sequence for this section of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHLSec2-irisin-his was a gift from Harold Erickson (Addgene plasmid # 122729 ; http://n2t.net/addgene:122729 ; RRID:Addgene_122729)
  • For your References section:

    Irisin - a myth rather than an exercise-inducible myokine. Albrecht E, Norheim F, Thiede B, Holen T, Ohashi T, Schering L, Lee S, Brenmoehl J, Thomas S, Drevon CA, Erickson HP, Maak S. Sci Rep. 2015 Mar 9;5:8889. doi: 10.1038/srep08889. 10.1038/srep08889 PubMed 25749243