pHAGE mNeonGreen-Core (HBc from HBV) IRES puro
(Plasmid #122202)

• Purpose: Plasmid coding for mNeonGreen-Core protein (from HBV AYW) and a puromycin resistance in a lentiviral backbone.
• Depositing Lab: Raphael Gaudin
• Publication: Hallez et al Nat Microbiol. 2019 Apr 1. pii: 10.1038/s41564-019-0405-x. doi: 10.1038/s41564-019-0405-x.

Backbone

• Vector backbone: pHAGE
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: HBc from HBV AYW
• Alt name: Core, capsid
• Insert Size (bp): 547

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: gcctcagacagtggttcaaagtttt
• 3′ sequencing primer: ctttataagggtcgatgtcggaac

Gene/Insert 2

• Gene/Insert name: mNeonGreen
• Alt name: mNG
• Insert Size (bp): 708
• Tag / Fusion Protein:
  • GGSGGSGGS linker (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: ATGGGCATGGACGAGCTGTACAA
• 3′ sequencing primer: cttcggccagtaacgttaggg

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry