pAG191 MDFIC 3'UTR
(Plasmid
#12018)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 12018 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIS2
-
Backbone manufacturerpIS2 derived from pRL-SV40 (Promega)
- Backbone size w/o insert (bp) 3700
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameN22 3'UTR
-
Alt nameMDFIC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)390
-
GenBank IDNM_199072
-
Entrez GeneMDFIC (a.k.a. HIC, LMPHM12, MDFIC1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
MDFIC 3'UTR in renilla luciferase reporter plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG191 MDFIC 3'UTR was a gift from David Bartel (Addgene plasmid # 12018 ; http://n2t.net/addgene:12018 ; RRID:Addgene_12018) -
For your References section:
The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP. Science. 2005 Dec 16. 310(5755):1817-21. 10.1126/science.1121158 PubMed 16308420