-
PurposeAll-in-one AAV plasmid expressing Nme2Cas9 with sgRNA cassette
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119924 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 2900
-
Modifications to backboneContains U6-driven sgRNA cassette
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNme2Cas9
-
Alt nameNme2Cas9c
-
SpeciesN. meningitidis
-
Insert Size (bp)3300
- Promoter U1a
-
Tags
/ Fusion Proteins
- NLS-NLS (N terminal on insert)
- NLS-3xHA-NLS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGATAAGCGGCCCGCAGCAA
- 3′ sequencing primer TTTCTTTTTCTTGGCTTGACCTGCCTTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Nme2Cas9_AAV was a gift from Erik Sontheimer (Addgene plasmid # 119924 ; http://n2t.net/addgene:119924 ; RRID:Addgene_119924) -
For your References section:
A Compact, High-Accuracy Cas9 with a Dinucleotide PAM for In Vivo Genome Editing. Edraki A, Mir A, Ibraheim R, Gainetdinov I, Yoon Y, Song CQ, Cao Y, Gallant J, Xue W, Rivera-Perez JA, Sontheimer EJ. Mol Cell. 2018 Dec 18. pii: S1097-2765(18)31033-5. doi: 10.1016/j.molcel.2018.12.003. 10.1016/j.molcel.2018.12.003 PubMed 30581144