pAAV_hsyn_NES-his-CaMPARI2-F391W-L398V
(Plasmid
#119723)
-
PurposeAAV vector expressing CaMPARI2_F391W-L398V (Kd = 174nM), a photoconvertible fluorescent protein-based calcium integrator, in neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4267
- Total vector size (bp) 5575
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCaMPARI2
-
SpeciesSynthetic
-
Insert Size (bp)1308
-
MutationF391W, L398V
- Promoter hSyn1
-
Tag
/ Fusion Protein
- NES-his (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer syn-sense2 GACTCAGCGCTGCCTCAGTCTG
- 3′ sequencing primer P5E gtaatccagaggttgattatcg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCaMPARI2
-
SpeciesSynthetic
-
Insert Size (bp)1308
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer syn-sense2 GACTCAGCGCTGCCTCAGTCTG
- 3′ sequencing primer P5E gtaatccagaggttgattatcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCaMPARI 2.0 was a kind gift of Eric Schreiter Lab (Janelia Farm)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_hsyn_NES-his-CaMPARI2-F391W-L398V was a gift from Thomas Oertner (Addgene plasmid # 119723 ; http://n2t.net/addgene:119723 ; RRID:Addgene_119723) -
For your References section:
Improved methods for marking active neuron populations. Moeyaert B, Holt G, Madangopal R, Perez-Alvarez A, Fearey BC, Trojanowski NF, Ledderose J, Zolnik TA, Das A, Patel D, Brown TA, Sachdev RNS, Eickholt BJ, Larkum ME, Turrigiano GG, Dana H, Gee CE, Oertner TG, Hope BT, Schreiter ER. Nat Commun. 2018 Oct 25;9(1):4440. doi: 10.1038/s41467-018-06935-2. 10.1038/s41467-018-06935-2 PubMed 30361563