pcDNA 3.3 HA-TSPAN12^11-LEL
(Plasmid
#115785)
-
PurposeExpresses a chimera in mammalian cells: the large extracellular loop of TSPAN12 is replaced with TSPAN11 sequence
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115785 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.3 TOPO TA
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5407
- Total vector size (bp) 6386
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTSPAN12/11 chimera
-
SpeciesH. sapiens (human)
-
Insert Size (bp)979
-
Mutationlarge extracellular loop of TSPAN12 replaced with TSPAN11 sequence
-
Entrez GeneTSPAN11 (a.k.a. VSSW1971)
-
Entrez GeneTSPAN12 (a.k.a. EVR5, NET-2, NET2, TM4SF12)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BstEII (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CTTCCGTGTTTCAGTTAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bygene synthesis
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA 3.3 HA-TSPAN12^11-LEL was a gift from Harald Junge (Addgene plasmid # 115785 ; http://n2t.net/addgene:115785 ; RRID:Addgene_115785) -
For your References section:
TSPAN12 Is a Norrin Co-receptor that Amplifies Frizzled4 Ligand Selectivity and Signaling. Lai MB, Zhang C, Shi J, Johnson V, Khandan L, McVey J, Klymkowsky MW, Chen Z, Junge HJ. Cell Rep. 2017 Jun 27;19(13):2809-2822. doi: 10.1016/j.celrep.2017.06.004. 10.1016/j.celrep.2017.06.004 PubMed 28658627