Skip to main content
Addgene

pNJP
(Plasmid #115494)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115494 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPB
  • Backbone manufacturer
    Allan Bradley (Wellcome Sanger Institute)
  • Backbone size w/o insert (bp) 6804
  • Total vector size (bp) 10722
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLS-iRFP-NLS-P2A-JNK KTR-mCherry-P2A-mKO-MK2
  • Alt name
    NJP (Nuclear, JNK, and p38 reporter)
  • Species
    H. sapiens (human), M. musculus (mouse), Synthetic
  • Insert Size (bp)
    3918
  • Mutation
    mCherry S227F, mCherry G229R, mKO V211G
  • Entrez Gene
    MAPK14 (a.k.a. CSBP, CSBP1, CSBP2, CSPB1, EXIP, Mxi2, PRKM14, PRKM15, RK, SAPK2A, p38, p38ALPHA)
  • Entrez Gene
    MAPK8 (a.k.a. JNK, JNK-46, JNK1, JNK1A2, JNK21B1/2, PRKM8, SAPK1, SAPK1c)
  • Promoter CAG
  • Tags / Fusion Proteins
    • mCherry (C terminal on insert)
    • mKO (N terminal on insert)
    • iRFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer catgttcatgccttcttctttttcc
  • 3′ sequencing primer gggccctcacattgccaaa
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Markus Covert (Stanford University)
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For JNK KTR, see also: Regot et al Cell. 2014 Jun 19;157(7):1724-34. doi: 10.1016/j.cell.2014.04.039.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNJP was a gift from Kazuhiro Aoki (Addgene plasmid # 115494 ; http://n2t.net/addgene:115494 ; RRID:Addgene_115494)
  • For your References section:

    Cell-to-Cell Heterogeneity in p38-Mediated Cross-Inhibition of JNK Causes Stochastic Cell Death. Miura H, Kondo Y, Matsuda M, Aoki K. Cell Rep. 2018 Sep 4;24(10):2658-2668. doi: 10.1016/j.celrep.2018.08.020. 10.1016/j.celrep.2018.08.020 PubMed 30184500