pAAV hSyn GFP-Fxr1
(Plasmid
#112732)
-
PurposeAAV plasmid that expresses GFP-Fxr1 fusion protein under hSYN promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112732 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4547
- Total vector size (bp) 7199
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFxr1p
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1863
-
Entrez GeneFxr1 (a.k.a. 1110050J02Rik, 9530073J07Rik, Fxr1h, Fxr1p)
- Promoter hSYN
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGGAGCTGACGGTGGAG
- 3′ sequencing primer TTATGAAACACCATTCAGGACTGCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV hSyn GFP-Fxr1 was a gift from Martin Beaulieu (Addgene plasmid # 112732 ; http://n2t.net/addgene:112732 ; RRID:Addgene_112732) -
For your References section:
Mental Illnesses-Associated Fxr1 and Its Negative Regulator Gsk3beta Are Modulators of Anxiety and Glutamatergic Neurotransmission. Khlghatyan J, Evstratova A, Chamberland S, Marakhovskaia A, Bahremand A, Toth K, Beaulieu JM. Front Mol Neurosci. 2018 Apr 12;11:119. doi: 10.3389/fnmol.2018.00119. eCollection 2018. 10.3389/fnmol.2018.00119 PubMed 29706865