-
PurposeLentiviral expression plasmid of spCas9 with puromycin resistance gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 108100 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLentiV_puro
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 11203
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
Alt nameS. pyogenes CRISPR-Cas9
-
SpeciesSynthetic
-
Insert Size (bp)4100
-
GenBank ID
- Promoter EFS promoter
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AACTGGGAAAGTGATGTCGTGTACTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LentiV_Cas9_puro was a gift from Christopher Vakoc (Addgene plasmid # 108100 ; http://n2t.net/addgene:108100 ; RRID:Addgene_108100) -
For your References section:
LKB1, Salt-Inducible Kinases, and MEF2C Are Linked Dependencies in Acute Myeloid Leukemia. Tarumoto Y, Lu B, Somerville TDD, Huang YH, Milazzo JP, Wu XS, Klingbeil O, El Demerdash O, Shi J, Vakoc CR. Mol Cell. 2018 Feb 28. pii: S1097-2765(18)30109-6. doi: 10.1016/j.molcel.2018.02.011. 10.1016/j.molcel.2018.02.011 PubMed 29526696