pX-evoCas9
(Plasmid #107550)

• Purpose: Expresses the M495V/Y515N/K526E/R661Q (evoCas9) SpCas9 variant in mammalian cells
• Depositing Lab: Anna Cereseto
• Publication: Casini et al Nat Biotechnol. 2018 Jan 29. pii: nbt.4066. doi: 10.1038/nbt.4066.

Backbone

• Vector backbone: PX330 (Addgene #42230)
• Total vector size (bp): 8090
• Modifications to backbone: Removed sgRNA expression cassette.
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Humanized S. pyogenes Cas9
• Alt name: hSpCas9
• Insert Size (bp): 4272
• Mutation: M495V/Y515N/K526E/R661Q
• Promoter: CBh
• Tag / Fusion Protein:
  • 3XFLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: agggatggttggttggtggg
• 3′ sequencing primer: CCAATCCTCCCCCTTGCTGT

Resource Information

• Supplemental Documents:
  • pX-evoCas9.gb
• A portion of this plasmid was derived from a plasmid made by: pX-evoCas9 was obtained through modifications of the PX330 backbone (Addgene #42230)
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry