LRG/Rosa26
(Plasmid
#105510)
-
PurposeLentiviral expression of Rosa26 targeting sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105510 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLenti_gRNA-GFP(LRG)
- Backbone size w/o insert (bp) 7409
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRosa26
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)20
-
Entrez GeneGt(ROSA)26Sor (a.k.a. Gtrgeo26, Gtrosa26, R26, ROSA26, Thumpd3as1)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sgRNA sequence: 5'-GAAGATGGGCGGGAGTCTTC-3'
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LRG/Rosa26 was a gift from Christopher Vakoc (Addgene plasmid # 105510 ; http://n2t.net/addgene:105510 ; RRID:Addgene_105510) -
For your References section:
Enhancer Reprogramming Promotes Pancreatic Cancer Metastasis. Roe JS, Hwang CI, Somerville TDD, Milazzo JP, Lee EJ, Da Silva B, Maiorino L, Tiriac H, Young CM, Miyabayashi K, Filippini D, Creighton B, Burkhart RA, Buscaglia JM, Kim EJ, Grem JL, Lazenby AJ, Grunkemeyer JA, Hollingsworth MA, Grandgenett PM, Egeblad M, Park Y, Tuveson DA, Vakoc CR. Cell. 2017 Aug 24;170(5):875-888.e20. doi: 10.1016/j.cell.2017.07.007. Epub 2017 Jul 27. 10.1016/j.cell.2017.07.007 PubMed 28757253