-
PurposeThis 3rd generation lentiviral construct delivers hSpCas9 and puromycin resistance.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104994 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiCRISPRv2 puro (Addgene #98290)
-
Backbone manufacturerBrett Stringer from Feng Zhang plasmid lentiCRISPR v2 (Addgene plasmid #52961)
- Total vector size (bp) 12671
-
Modifications to backboneThe first of the two MluI restriction sites of lentiCRISPR v2 (Addgene plasmid #52961) was mutated (to create lentiCRISPRv2 puro, Addgene plasmid #98290) to allow the subcloning of alternative P2A-antibiotic resistance cassettes between the BamHI and remaining MluI restriction site (see also lentiCRISPRv2 hygro, Addgene plasmid #98291; lentiCRISPRv2 neo, Addgene plasmid #98292; and lentiCRISPRv2 blast, Addgene plasmid #98293). The U6 promoter-2 kb BsmBI-BsmBI filler cassette of lentiCRISPRv2 puro (Addgene plasmid #98290) was removed by KpnI/NheI digestion and a KpnI-XhoI-BsrGI-NheI double-stranded oligonucleotide sequence was cloned in its place between the KpnI and NheI restriction sites (see also lentiCas9 hygro, Addgene plasmid #104995; lentiCas9 neo, Addgene plasmid #104996; and lentiCas9 blast, Addgene plasmid #104997).
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl4
-
Growth instructionsSingle colonies of transformed STBL3 or STBL4 cells cultured in 5 ml of LB broth containing 100 micrograms/ml ampicillin for 20 hours at 37C, 200 rpm give good yields for plasmid minipreps.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKpnI-XhoI-BsrGI-NheI
-
SpeciesSynthetic
-
Insert Size (bp)24
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer acagtgcaggggaaagaatagtaga
- 3′ sequencing primer aagcagcgtatccacatagc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFeng Zhang (Addgene plasmid # 52961)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti-SpCas9 puro was a gift from Brett Stringer (Addgene plasmid # 104994 ; http://n2t.net/addgene:104994 ; RRID:Addgene_104994) -
For your References section:
A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Stringer BW, Day BW, D'Souza RCJ, Jamieson PR, Ensbey KS, Bruce ZC, Lim YC, Goasdoue K, Offenhauser C, Akgul S, Allan S, Robertson T, Lucas P, Tollesson G, Campbell S, Winter C, Do H, Dobrovic A, Inglis PL, Jeffree RL, Johns TG, Boyd AW. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. 10.1038/s41598-019-41277-z PubMed 30894629