sgp27#1
(Plasmid
#102759)
-
PurposeExpresses sgRNA targeting mouse p27
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102759 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiCRISPR v2
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep27
-
Alt nameCdkn1b
-
Alt nameKIP1
-
gRNA/shRNA sequenceTCAAACGTGAGAGTGTCTAA
-
SpeciesM. musculus (mouse)
-
Entrez GeneCdkn1b (a.k.a. Kip1, p27, p27Kip1)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
- 5′ sequencing primer U6 F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgp27#1 was a gift from Jin Chen (Addgene plasmid # 102759 ; http://n2t.net/addgene:102759 ; RRID:Addgene_102759) -
For your References section:
Targeting EphA2 impairs cell cycle progression and growth of basal-like/triple-negative breast cancers. Song W, Hwang Y, Youngblood VM, Cook RS, Balko JM, Chen J, Brantley-Sieders DM. Oncogene. 2017 Jun 5. doi: 10.1038/onc.2017.170. 10.1038/onc.2017.170 PubMed 28581527