pDG335
(Plasmid
#100899)
-
PurposeSpCas9n (D10A Nickase mutant) with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100899 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)
- Backbone size w/o insert (bp) 8434
- Total vector size (bp) 8840
-
Modifications to backboneInsertion of 2nd U6-gRNA scaffold.
-
Vector typeMammalian Expression, Mouse Targeting, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehumanized CRISPR associated protein 9 Nickase
-
Alt nameCas9n
-
Alt namehSpCas9n
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4101
-
MutationD10A mutant converts to Nickase
- Promoter CBh
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer Unknown (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameU6-gRNA scaffold 1
-
Insert Size (bp)342
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer Unknown (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameU6-gRNA scaffold 2
-
Insert Size (bp)343
- Promoter U6
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer bgh PA F TGCATCGCATTGTCTGAGTAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byFeng Zhang
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Modified from pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (https://www.addgene.org/42335/).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDG335 was a gift from Paul Thomas (Addgene plasmid # 100899 ; http://n2t.net/addgene:100899 ; RRID:Addgene_100899) -
For your References section:
Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression. Adikusuma F, Pfitzner C, Thomas PQ. PLoS One. 2017 Dec 6;12(12):e0187236. doi: 10.1371/journal.pone.0187236. eCollection 2017. PONE-D-17-32080 [pii] PubMed 29211736