B52 + SPRTN sgSTOP
(Plasmid
#100709)
-
PurposeB52 plasmid expressing SPRTN sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100709 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneB52 plasmid expressing SPRTN sgSTOP and containing an empty sgRNA-expression cassette
- Total vector size (bp) 2635
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgSTOP targeting SPRTN (cloned using BbsI)
-
gRNA/shRNA sequencesgSTOP SPRTN: GGGCCAGCTGGAGGCCGTCG
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGTACCTCGAGGAATTCTCTAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
B52 + SPRTN sgSTOP was a gift from Alberto Ciccia (Addgene plasmid # 100709 ; http://n2t.net/addgene:100709 ; RRID:Addgene_100709) -
For your References section:
CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons. Billon P, Bryant EE, Joseph SA, Nambiar TS, Hayward SB, Rothstein R, Ciccia A. Mol Cell. 2017 Sep 4. pii: S1097-2765(17)30605-6. doi: 10.1016/j.molcel.2017.08.008. 10.1016/j.molcel.2017.08.008 PubMed 28890334