pDule-Tet2.0
(Plasmid
#85496)
-
PurposePlasmid for incorporating the non-canonical amino acid Tetrazine 2.0 with the Mj Tet2.0 synthetase and cognate amber suppressing tRNA in Ecoli.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDule
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6300
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTetrazine2.0 tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
-
Alt nameTet2.0 synthetase
-
SpeciesMethanocaldococcus jannaschii
-
Insert Size (bp)921
-
MutationY32G L65Q F108S Q109D D158S L162N
- Promoter lpp (constitutive)
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CGTCACTGCGTCTTTTACTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDule-Tet2.0 was a gift from Ryan Mehl (Addgene plasmid # 85496 ; http://n2t.net/addgene:85496 ; RRID:Addgene_85496) -
For your References section:
Ideal Bioorthogonal Reactions Using A Site-Specifically Encoded Tetrazine Amino Acid. Blizzard RJ, Backus DR, Brown W, Bazewicz CG, Li Y, Mehl RA. J Am Chem Soc. 2015 Aug 19;137(32):10044-7. doi: 10.1021/jacs.5b03275. Epub 2015 Aug 10. 10.1021/jacs.5b03275 PubMed 26237426