pBS1ClacZ
(Plasmid
#55171)
-
Purpose(Empty Backbone) lacZ-reporter vector, integration at amyE, ampr, cmr
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 55171 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAC6
-
Backbone manufacturerStulke, et al 1997
-
Modifications to backbonepAC6blamut was cut with EcoRI and PstI. The primers TM2301 and TM2302 (1 pM) were mixed, heated (95°C, 10 min), re-annealed (50°C, 10 min) to become double stranded with 4 bp overhangs and ligated into the vector. The vector was cut with EcoRI and PstI and ligated with the MCS from pSB1C3 cut with EcoRI and PstI. A PstI site in the E. coli ori was removed by cutting with BglII and religation of the 11 kb fragment.
-
Vector typeSynthetic Biology ; Bacillus BioBrick Box
- Promoter none
-
Selectable markerschloramphenicol resistance in B. subtilis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This reporter vector allows the measurement of promoter activity based on transcriptional fusions and mediates chloramphenicol resistance. It integrates into the amyE locus.
For sequencing of inserts, use the following primers:
fwd: TTTGAGCGTAGCGAAAAATCC
rev: CCCAGTCACGTTGTAAAACG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS1ClacZ was a gift from Thorsten Mascher (Addgene plasmid # 55171 ; http://n2t.net/addgene:55171 ; RRID:Addgene_55171) -
For your References section:
The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. Radeck J, Kraft K, Bartels J, Cikovic T, Durr F, Emenegger J, Kelterborn S, Sauer C, Fritz G, Gebhard S, Mascher T. J Biol Eng. 2013 Dec 2;7(1):29. doi: 10.1186/1754-1611-7-29. 10.1186/1754-1611-7-29 PubMed 24295448
Map uploaded by Addgene staff.