pHL1506
(Plasmid
#53026)
-
PurposePLlacO-1:RBS(st7):csrA
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53026 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneunknown
-
Backbone manufacturerLim lab
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecsrA
-
SpeciesE.coli
- Promoter pLlac0-1
-
Tag
/ Fusion Protein
- RBS(st7) (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer K1 CAGTCATAGCCGAATAGCCT
- 3′ sequencing primer AspTerm ACTGCTCACAAGAAAAAAGGCACG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHL1506 was a gift from Han Lim (Addgene plasmid # 53026 ; http://n2t.net/addgene:53026 ; RRID:Addgene_53026) -
For your References section:
Rapid and robust signaling in the CsrA cascade via RNA-protein interactions and feedback regulation. Adamson DN, Lim HN. Proc Natl Acad Sci U S A. 2013 Aug 6;110(32):13120-5. doi: 10.1073/pnas.1308476110. Epub 2013 Jul 22. 10.1073/pnas.1308476110 PubMed 23878244
Map uploaded by the depositor.