-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45446 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCI
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4006
- Total vector size (bp) 8996
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNR1
-
Alt nameNMDAR1
-
Alt nameGrin1
-
Alt nameGluN1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)5000
-
MutationEGFP inserted after the predicted signal peptide cleavage site (after amino acid residue 26)
-
GenBank ID
-
Entrez GeneGrin1 (a.k.a. GluN1, NMDAR1, NR1)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer T7; chim-int-F (TCTTACTGACATCCACTTTGCC)
- 3′ sequencing primer EBV-rev (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byRat NMDA receptor genes originally cloned by Shigetada Nakanishi (PMID: 1834949)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-EGFP-NR1 wt was a gift from Andres Barria & Robert Malinow (Addgene plasmid # 45446 ; http://n2t.net/addgene:45446 ; RRID:Addgene_45446) -
For your References section:
Subunit-specific NMDA receptor trafficking to synapses. Barria A, Malinow R. Neuron. 2002 Jul 18;35(2):345-53. 10.1016/S0896-6273(02)00776-6 PubMed 12160751