pRAJ23
(Plasmid
#39253)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 39253 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSTC0
-
Backbone manufacturerJaramillo Lab
- Backbone size w/o insert (bp) 4042
- Total vector size (bp) 4452
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRAJ23 system
- Promoter pLlacO-1+pLtetO-1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer attaccgcctttgagtgagc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhttp://partsregistry.org/Part:pSB1AK3
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRAJ23 was a gift from Alfonso Jaramillo (Addgene plasmid # 39253 ; http://n2t.net/addgene:39253 ; RRID:Addgene_39253) -
For your References section:
De novo automated design of small RNA circuits for engineering synthetic riboregulation in living cells. Rodrigo G, Landrain TE, Jaramillo A. Proc Natl Acad Sci U S A. 2012 Sep 18;109(38):15271-6. Epub 2012 Sep 4. 10.1073/pnas.1203831109 PubMed 22949707