-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26395 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP C1
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 3984
-
Vector typeMammalian Expression ; FRET standard
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCerulean-17-Venus
-
Alt nameC17V
-
SpeciesGFP Varient
-
Insert Size (bp)1493
-
Tags
/ Fusion Proteins
- Cerulean (N terminal on insert)
- Venus (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe 1 (not destroyed)
- 3′ cloning site Bam HI (not destroyed)
- 5′ sequencing primer CCAAAATCAACGGGACTTTCC
- 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
FRET standard
This construct contains Cerulean attached via a 17 amino acid linker to Venus
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
C17V was a gift from Steven Vogel (Addgene plasmid # 26395 ; http://n2t.net/addgene:26395 ; RRID:Addgene_26395) -
For your References section:
Cerulean, Venus, and VenusY67C FRET reference standards. Koushik SV, Chen H, Thaler C, Puhl HL, Vogel SS. Biophys J. 2006 Dec 15. 91(12):L99-L101. 10.1529/biophysj.106.096206 PubMed 17040988