pMLLKA-J72025
(Plasmid
#26016)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 26016 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMLL-KA
- Backbone size w/o insert (bp) 2646
-
Vector typeSynthetic Biology ; 2ab assembly vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Other
-
Growth instructionsProvided in a pir+ strain. Grow at 37C
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameN terminal T7 tag with RBS
-
Alt nameBmll52
-
Alt nameJ72025
-
Insert Size (bp)73
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer gtatcacgaggcagaatttcag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that this plasmid needs to be grown in both Kanamycin and Ampicillin
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMLLKA-J72025 was a gift from Christopher Anderson (Addgene plasmid # 26016 ; http://n2t.net/addgene:26016 ; RRID:Addgene_26016)