peSCBE3-NG-HF1-Hypa
(Plasmid #218166)

• Purpose: This plasmid harbors the base editor eSCBE3-NG-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-efficiency and high-fidelity base editing at targets bearing NG PAM in Streptomyces.
• Depositing Lab: Yuhui Sun
• Publication: Sun Lab pre-publication base editors (unpublished)

Backbone

• Vector backbone: pSCBE3
• Backbone manufacturer: Jian Wang
• Backbone size w/o insert (bp): 8525
• Vector type: Bacterial Expression, CRISPR ; sgRNA transcription

Growth in Bacteria

• Bacterial Resistance(s): Apramycin, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: escbe3-NG-HF1-Hypa
• Species: S. coelicolor (bacteria)
• Insert Size (bp): 5106
• Mutation: Mutation in the portion of deaminase hAPOBEC3A : Y130F, mutations in the portion of SpCas9 : D10A / N497A / R661A / N692A / M694A / Q695A / H698A / Q926A / L1111R / D1135V / G1218R / E1219F / A1322R / R1335V / T1337R.
• Promoter: rpsL promoter

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCTGCTCTCACGCAACGTCTAC
• 3′ sequencing primer: ATCCGCTTGCCCTCATCTGT

Gene/Insert 2

• Gene/Insert name: a programmable sgRNA cloning cassette
• Species: Synthetic

Resource Information

• Supplemental Documents:
  • peSCBE3-NG-HF1-Hypa.gb
• A portion of this plasmid was derived from a plasmid made by: Original clone

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Another insert : a programmable sgRNA cloning cassette